Sequence ID | >W1810536719 |
Genome ID | QDEO01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus G219 [QDEO] |
Start position on genome | 1577406 |
End posion on genome | 1577332 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gcaggtccga |
tRNA gene sequence |
CGGGGTGTAGCGCAGCTTGGTAGCGCATCCGCTTTGGGAGCGGAGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
cacgacagta |
Secondary structure (Cloverleaf model) | >W1810536719 Pro TGG a ACag cacgacagta C - G G - C G - C G - C G - C T - A G - C T A T T G T C C A C G A A + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |