Sequence ID | >SRA1006875 |
Genome ID | SRR020488.244769 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 42 |
End posion on genome | 117 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aatgattact |
tRNA gene sequence |
GCCACCGTAACTCAGTTGGTAGAGTAGTTCATTCGTAATGAACAAGTCGCTGGTTCGAAT |
Downstream region at tRNA end position |
tactagtctt |
Secondary structure (Cloverleaf model) | >SRA1006875 Thr CGT t TCTA tactagtctt G - C C - G C - G A - T C - G C - G G - C T A T T G A C C A T G A A + | | | | G T C T C A G C T G G C G | | | | T T G G A G T T A A AAGTC G - C T - A T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |