Sequence ID | >SRA1006878 |
Genome ID | SRR020488.245840 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 115 |
End posion on genome | 39 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tgcgatattt |
tRNA gene sequence |
GTCCTCGTAGCTCAGTAGGATAGAGCGTGGGATTCCTAATCCTGAGGCCACAGGTTCGAT |
Downstream region at tRNA end position |
tctattatga |
Secondary structure (Cloverleaf model) | >SRA1006878 Arg CCT t ACCA tctattatga G - C T - A C - G C - G T - A C - G G - C T T T T G T C C A T G A A | | | | | G A C T C G A C A G G C G | | | | T T G G A G C A T A G AGGCC T + G G + T G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |