Sequence ID | >SRA1007078 |
Genome ID | SRR020488.325709 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 263 |
End posion on genome | 189 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
nnntttaaaT |
tRNA gene sequence |
GCGTCGTTAGTTCAGTTGGTAGAACGCAGGTCTCCAAAACCTGATGTCGGGGGTTCAAGT |
Downstream region at tRNA end position |
gatcaacatt |
Secondary structure (Cloverleaf model) | >SRA1007078 Trp CCA T GTtt gatcaacatt G - C C - G G - C T - A C - G G - C T - A T G T C C T C C A T G A A | | + | | A T C T T G G G G G G C G | | | | T T G G A A C T A G ATGTC C - G A - T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |