| Sequence ID | >SRA1007098 |
| Genome ID | SRR020488.333752 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
20
|
|
End posion on genome
|
95
|
|
Amino Acid
|
Ala
|
|
Anticodon
|
TGC
|
|
Upstream region at tRNA start position
|
aagccaatct
|
|
tRNA gene sequence
|
GGGGGTATAGCTCAGCTGGGAGAGCGCTTGATTTGCATTCAAGAGGTCATCGGTTCGATC CCGTTTACCTCCACCA
|
|
Downstream region at tRNA end position
|
tttttttgga
|
| Secondary structure (Cloverleaf model) | >SRA1007098 Ala TGC
t ACCA tttttttgga
G - C
G - C
G + T
G - C
G - C
T - A
A - T C T
T T T G C C A
C G A A | | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
T - A
T - A
G - C
A - T
T T
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |