Sequence ID | >SRA1007125 |
Genome ID | SRR020488.344091 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 13 |
End posion on genome | 99 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aggtgtattt |
tRNA gene sequence |
GCCTGCGTGGTGGAATGGTAGACACAAGAGACTTAAAATCTTTGGGCTTAATAGGCCGTG |
Downstream region at tRNA end position |
gattttggct |
Secondary structure (Cloverleaf model) | >SRA1007125 Leu TAA t ACTA gattttggct G + T C - G C - G T + G G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G A GGGCTTAATAGGCCGT A - T G + T A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |