Sequence ID | >SRA1007141 |
Genome ID | SRR020488.350029 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 86 |
End posion on genome | 161 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaattcttaa |
tRNA gene sequence |
TCCCCAATAGCTCAGTTGGTAGAGCAGATGACTGTTAATCATCGGGTCGCTGGTTCGAGT |
Downstream region at tRNA end position |
aaaaataaac |
Secondary structure (Cloverleaf model) | >SRA1007141 Asn GTT a GCCA aaaaataaac T - A C - G C - G C - G C - G A - T A - T T G T C G G C C A T G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A A GGGTC G - C A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |