| Sequence ID | >W1810568849 |
| Genome ID | QEEX01000001 |
| Phylum/Class | Actinomycetota |
| Species | Salinibacterium hongtaonis S1194 [QEEX] |
| Start position on genome | 1234769 |
| End posion on genome | 1234696 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
tcgatgccga |
| tRNA gene sequence |
AGGGCGGTGGCTCAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGCAGGTTCGAGT |
| Downstream region at tRNA end position |
cgtgatcagc |
| Secondary structure (Cloverleaf model) | >W1810568849 Trp CCA
a GCag cgtgatcagc
A - T
G - C
G - C
G - C
C - G
G - C
G - C T G
T T G T C C A
T A A G + | | | | G
T C T C G G C A G G C
G | | | | T T
G G A G C
T A A AGGTT
G - C
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |