Sequence ID | >W1810570312 |
Genome ID | QEII01000272 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Rhodoferax ferrireducens OTU1 [QEII] |
Start position on genome | 63295 |
End posion on genome | 63220 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agttttatat |
tRNA gene sequence |
TCCTCGATAGCTCAGTTGGTAGAGCGCCGGACTGTTAATCCGTAGGTCCCTGGTTCGAGC |
Downstream region at tRNA end position |
aaataaatag |
Secondary structure (Cloverleaf model) | >W1810570312 Asn GTT t GCCA aaataaatag T - A C - G C - G T - A C - G G - C A - T C G T G G A C C A T G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A G AGGTC C T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |