Sequence ID | >SRA1007220 |
Genome ID | SRR020488.379455 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 235 |
End posion on genome | 161 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cttatattca |
tRNA gene sequence |
GAGCCCGTAGCTCAGCGGTAGAGCATTCGCCTTTTAAGCGAGGGGCCCTGGGTTCGAATC |
Downstream region at tRNA end position |
agttaaaaac |
Secondary structure (Cloverleaf model) | >SRA1007220 Lys TTT a ACCA agttaaaaac G - C A - T G - C C - G C - G C - G G - C T A T G A C C C A G A A | | | | | G C C T C G C T G G G C G | | | | T T G G A G C T A A GGGCC T + G T - A C - G G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |