Sequence ID | >W1810573535 |
Genome ID | QEKU01000001 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Acidovorax sp. 99 [QEKU] |
Start position on genome | 3213423 |
End posion on genome | 3213336 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cttccctccc |
tRNA gene sequence |
GGAGACTTGGGTGAGTGGTTTAAACCAGCAGTCTTGAAAACTGCCGACGGGCAACCGTCC |
Downstream region at tRNA end position |
gttagtaagc |
Secondary structure (Cloverleaf model) | >W1810573535 Ser TGA c GCCA gttagtaagc G - C G - C A - T G - C A - T C - G T - A T A T C A C T C A T G A G | | | | | G G G T G G G T G A G C G | | | T T T A A C C T T A A CGACGGGCAACCGTCC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |