Sequence ID | >SRA1007249 |
Genome ID | SRR020488.387292 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 288 |
End posion on genome | 212 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnnttaa |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCAGTACACTCATAATGTATTGGTCCCAGGTTCGAG |
Downstream region at tRNA end position |
aattataata |
Secondary structure (Cloverleaf model) | >SRA1007249 Met CAT a ACAA aattataata G - C G - C G - C C - G C - G T + G G - C T G T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T T A A TGGTC G + T T - A A - T C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |