Sequence ID | >W1810577611 |
Genome ID | QEOJ01000003 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Rhodoferax sp. YR267 [QEOJ] |
Start position on genome | 501698 |
End posion on genome | 501614 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
agtttcgtgg |
tRNA gene sequence |
GCCCAGATGGCGAAATTGGTAGACGCACTGTGTTCAGGTCGCAGCGCTGCAAGGCGTGCT |
Downstream region at tRNA end position |
caatttactc |
Secondary structure (Cloverleaf model) | >W1810577611 Leu CAG g ACCA caatttactc G - C C - G C - G C - G A - T G - C A - T T G T T G A C C A T A A G + | | | | G T A G C G G C T G G C G | | | T T G A C G C T A G A CGCTGCAAGGCGT C - G T - A G - C T + G G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |