| Sequence ID | >W1810584081 |
| Genome ID | QEYF01000081 |
| Phylum/Class | Gammaproteobacteria |
| Species | Francisella tularensis subsp. holarctica 14T0103 [QEYF] |
| Start position on genome | 1970 |
| End posion on genome | 2046 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
aatagaatac |
| tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTAGTTCAAG |
| Downstream region at tRNA end position |
ttttaggttt |
| Secondary structure (Cloverleaf model) | >W1810584081 Ile GAT
c ACCA ttttaggttt
G - C
G - C
G - C
T - A
C - G
T - A
G - C T G
T T C A T C A
T G A A + | | | | A
T C T C G G G T A G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |