Sequence ID | >SRA1007343 |
Genome ID | SRR020488.417219 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 103 |
End posion on genome | 175 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaaatatcaa |
tRNA gene sequence |
GAGCCTGTGGCGCAACGGTTAGCGCGTCGGATTCCAGACCCGAAGGTTGGGGGTTCAAAT |
Downstream region at tRNA end position |
ccagtggtct |
Secondary structure (Cloverleaf model) | >SRA1007343 Trp CCA a Aggg ccagtggtct G - C A - T G - C C - G C - G T - A G - C T A T C T C C C A C A A G | + | | | A G C G C G G G G G G C G | | | | T T T G C G C T A G AGGTT T - A C - G G - C G - C A C T A T G C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |