Sequence ID | >SRA1007346 |
Genome ID | SRR020488.417709 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 182 |
End posion on genome | 97 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tagtattncg |
tRNA gene sequence |
GGGGAGATGCCCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCGTATGCCTTCGG |
Downstream region at tRNA end position |
ttggcgagtg |
Secondary structure (Cloverleaf model) | >SRA1007346 Tyr GTA g ACCG ttggcgagtg G - C G - C G - C G - C A - T G - C A - T T A T C T T C C A C G A G | + | | | G G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCGTATGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |