Sequence ID | >SRA1007350 |
Genome ID | SRR020488.418532 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 263 |
End posion on genome | 190 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaattaattt |
tRNA gene sequence |
TGGGGTGTAGCCAAGCGGTAAGGCAGCGGTTTTTGGTACCGCCATCCTAGGTTCGAATCC |
Downstream region at tRNA end position |
attatgaaaa |
Secondary structure (Cloverleaf model) | >SRA1007350 Gln TTG t GCCA attatgaaaa T - A G - C G - C G - C G - C T - A G - C T A T G A T C C A G A A | | | | | G C A C C G C T A G G C G | | | T T G A G G C T A A CATC G - C C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |