| Sequence ID | >W1810587166 |
| Genome ID | QFFY01000006 |
| Phylum/Class | Acidobacteriota |
| Species | Occallatibacter savannae AB23 [QFFY] |
| Start position on genome | 309028 |
| End posion on genome | 308953 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
atttcaatga |
| tRNA gene sequence |
GCGCCGGTGGCGAAGTGGCTAACGCGCTGGCCTGCAAAGCCAGTATCCGCGGGTTCGATT |
| Downstream region at tRNA end position |
actcgtcagg |
| Secondary structure (Cloverleaf model) | >W1810587166 Cys GCA
a TCCA actcgtcagg
G - C
C - G
G - C
C - G
C - G
G - C
G A T T
T C G C C C A
T G A G | | | | | G
G A G C G G C G G G C
G | | | T T
C A C G C
T A G TATCC
C - G
T - A
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |