Sequence ID | >SRA1007463 |
Genome ID | SRR020489.3919 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 22 |
End posion on genome | 97 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggttctaaat |
tRNA gene sequence |
GCCCTTGTAGCTCAGCTGGTAGAGCAATTGATTTGTAATCAATAGGTCCGCGGTTCGAAT |
Downstream region at tRNA end position |
cttcacttac |
Secondary structure (Cloverleaf model) | >SRA1007463 Thr TGT t ACCA cttcacttac G - C C - G C - G C - G T + G T + G G - C T A T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T T - A T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |