Sequence ID | >SRA1007516 |
Genome ID | SRR020489.49541 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 28 |
End posion on genome | 102 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
aaaataataa |
tRNA gene sequence |
TGTCTTATAACTCAGTTGGTTAGAGTGGTGGTCTTATGAGCCGCAAGTCGTGGGTTCAAG |
Downstream region at tRNA end position |
ggatttattt |
Secondary structure (Cloverleaf model) | >SRA1007516 Ile TAT a ACat ggatttattt T - A G - C T - A C - G T - A T - A A - T T G T C A C C C A T G A A | | | | | A T C T C A G T G G G C G | | | | T T G G A G T T T A G AAGTC G - C T + G G - C G - C T + G C A T G T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |