Sequence ID | >W1810603260 |
Genome ID | QGLC01000009 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi RC [QGLC] |
Start position on genome | 412593 |
End posion on genome | 412669 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atttcgtcgt |
tRNA gene sequence |
GTCCCCGTAGCTCAGTTGGATAGAGCAACTGCCTTCTAAGTAGTGGGCCGAGAGTTCGAA |
Downstream region at tRNA end position |
cttggttttt |
Secondary structure (Cloverleaf model) | >W1810603260 Arg TCT t GCCA cttggttttt G - C T - A C - G C - G C - G C - G G - C T A T C T C T C A T G A A | | | | | G T C T C G G A G A G C G | | | | T T G G A G C A T A A GGGCC A - T C - G T - A G + T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |