Sequence ID | >SRA1007644 |
Genome ID | SRR020489.169368 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 119 |
End posion on genome | 32 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cgcatgattT |
tRNA gene sequence |
GCGGCCATGCTGAAATTGGTAGACAGGCACGGTTGAGGGCCGTGTGGGCTTAGCCCATGA |
Downstream region at tRNA end position |
Aaaaaattag |
Secondary structure (Cloverleaf model) | >SRA1007644 Leu GAG T AACC Aaaaaattag G - C C - G G - C G - C C - G C - G A - T T T T C T C T C A T A A G | | | | | G T A G T C G A G A G C G | | | T T G A C A G T A G G TGGGCTTAGCCCAT C - G A - T C - G G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |