Sequence ID | >W1810626019 |
Genome ID | QHKP01000020 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Notoacmeibacter marinus HMA008 [QHKP] |
Start position on genome | 2579 |
End posion on genome | 2654 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
acaacttatc |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCATCTGCTTTGCAAGCAGAGGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
ttcctctctt |
Secondary structure (Cloverleaf model) | >W1810626019 Ala TGC c ACCA ttcctctctt G - C G - C G + T G - C C - G C - G T - A C T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |