Sequence ID | >SRA1007756 |
Genome ID | SRR020490.42090 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 88 |
End posion on genome | 160 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctttaatatt |
tRNA gene sequence |
GCCCTTGTAGCTCAGCGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCTCGGGTTCAAGTC |
Downstream region at tRNA end position |
gctaagggta |
Secondary structure (Cloverleaf model) | >SRA1007756 Thr GGT t ACtt gctaagggta G - C C - G C - G C - G T - A T + G G - C T G T A G C C C A G A A | | | | | A C C T C G T C G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |