| Sequence ID | >W1810626572 |
| Genome ID | QHLF01000004 |
| Phylum/Class | Gammaproteobacteria |
| Species | Proteus mirabilis 11985-2-3 [QHLF] |
| Start position on genome | 21595 |
| End posion on genome | 21519 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
taaacaacgt |
| tRNA gene sequence |
GCATCCTTAGCTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
cttatttctc |
| Secondary structure (Cloverleaf model) | >W1810626572 Arg ACG
t ACCA cttatttctc
G - C
C - G
A - T
T - A
C - G
C - G
T - A T A
T C C T C C A
C G A A | | | | | G
T C T C G G G A G G C
G | | | + T T
G G A G T
A T A A CGGTC
C - G
T - A
C - G
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |