Sequence ID | >SRA1007848 |
Genome ID | SRR020490.93012 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 99 |
End posion on genome | 28 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tggttcgata |
tRNA gene sequence |
GGGTCGCTAGCTCAGTGGTAGAGCATCCGGCTTTTAACCGGCTGGTCCTGAGTTCGAATC |
Downstream region at tRNA end position |
aaattgaaga |
Secondary structure (Cloverleaf model) | >SRA1007848 Lys TTT a Attt aaattgaaga G - C G - C G - C T - A C - G G - C C - G T A T G A C T C A G A A | | | | | G T C T C G C T G A G C G | | | | T T G G A G C T A A TGGTC T C C - G C - G G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |