Sequence ID | >SRA1007870 |
Genome ID | SRR020490.101947 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 113 |
End posion on genome | 38 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
atgattgcgt |
tRNA gene sequence |
GCCTCGGTAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
acttttcaaa |
Secondary structure (Cloverleaf model) | >SRA1007870 Phe GAA t ACCT acttttcaaa G - C C - G C - G T - A C - G G + T G - C C G T C C G C C A T G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC A - T T - A G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |