Sequence ID | >SRA1007990 |
Genome ID | SRR020490.153665 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 260 |
End posion on genome | 169 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttggttattt |
tRNA gene sequence |
GGAAGAGTGGGTGAGCGGTTGAAACCAGTTGGTTGCTAACTAACCGTACGAGTAATATCG |
Downstream region at tRNA end position |
aagttaatta |
Secondary structure (Cloverleaf model) | >SRA1007990 Ser GCT t GCCA aagttaatta G - C G - C A - T A - T G - C A - T G - C T A T C T C T C A C G A G | | | | | G G G T G G G A G A G C G | | | T T T A A C C T G A A CGTACGAGTAATATCGTACC G - C T - A T - A G + T G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |