| Sequence ID | >SRA1008120 |
| Genome ID | SRR020490.212368 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
133
|
|
End posion on genome
|
206
|
|
Amino Acid
|
Thr
|
|
Anticodon
|
CGT
|
|
Upstream region at tRNA start position
|
agatattaaT
|
|
tRNA gene sequence
|
GCCGGTATAGCTCAGCGGTAGAGCAACTGTCTCGTAAACAGTAGGTCATTGGTTCAATTC CAATTATCGGCATtt
|
|
Downstream region at tRNA end position
|
caaaagcaaa
|
| Secondary structure (Cloverleaf model) | >SRA1008120 Thr CGT
T ATtt caaaagcaaa
G - C
C - G
C - G
G - C
G + T
T - A
A - T T T
T T A A C C A
G A A | | | | | A
C C T C G A T T G G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
T - A
G - C
T - A
C A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |