Sequence ID | >SRA1008190 |
Genome ID | SRR020490.245735 |
Search identical group | |
Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
Species | |
Start position on genome | 141 |
End posion on genome | 53 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tttttcgccT |
tRNA gene sequence |
GGAGGGGTGGTCGAGTGGTTTAAGGCTCTAGTCTTGAAAACTAGCGTATCTGCAAGGGTA |
Downstream region at tRNA end position |
taatatcgaa |
Secondary structure (Cloverleaf model) | >SRA1008190 Ser TGA T GTtc taatatcgaa G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C T G G T G G G C G | + | T T T A G G C T T A T CGTATCTGCAAGGGTACC C - G T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |