Sequence ID | >W1810671445 |
Genome ID | QJSU01000009 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Psychrobacter fozii CECT 5889 [QJSU] |
Start position on genome | 70035 |
End posion on genome | 69959 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
agtatattat |
tRNA gene sequence |
GCGCTCGTAGCTCAGTTGGATAGAGTATCGGTCTCCGAAGCCGAGGGTCGTGGGTTCGAT |
Downstream region at tRNA end position |
atcatcgtat |
Secondary structure (Cloverleaf model) | >W1810671445 Arg CCG t ACCA atcatcgtat G - C C - G G - C C - G T - A C - G G - C T T T C G C C C A T G A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC T - A C - G G - C G - C T + G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |