Sequence ID | >W1810673497 |
Genome ID | QJUE01000005 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus marinus XMU1408 [QJUE] |
Start position on genome | 101445 |
End posion on genome | 101518 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gattcatcaa |
tRNA gene sequence |
GCTCCCTTAGCTCAGCTGGATAGAGCAACTGCCTTCTAAGCAGTGGGCCGCTGGTTCGAA |
Downstream region at tRNA end position |
tcaagcaact |
Secondary structure (Cloverleaf model) | >W1810673497 Arg TCT a Gtac tcaagcaact G - C C - G T - A C - G C - G C - G T - A T A T C G A C C A C G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |