Sequence ID | >W1810674014 |
Genome ID | QJVE01000008 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Arthrobacter stackebrandtii CCM 2783 [QJVE] |
Start position on genome | 164571 |
End posion on genome | 164498 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cttgcttcat |
tRNA gene sequence |
TCCCCTATAGCTCAATTGGCAGAGCGTTCGACTGTTAATCGAAAGGTTCCTGGTTCAAGT |
Downstream region at tRNA end position |
ttcaagaaga |
Secondary structure (Cloverleaf model) | >W1810674014 Asn GTT t GCtt ttcaagaaga T - A C - G C - G C - G C - G T + G A - T T G T G G A C C A T A A A | | | | | A T C T C G C C T G G C G | | | | T T G G A G C C A G AGGTT T - A T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |