Sequence ID | >W1810681914 |
Genome ID | QKTG01000040 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Curtobacterium sp. MCLR17_036 [QKTG] |
Start position on genome | 20761 |
End posion on genome | 20836 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ttgtcggaac |
tRNA gene sequence |
GGCCCCATCGTATAGCGGCCTAGTACGCTGCCCTCTCACGGCGGTAACGCGGGTTCGAAT |
Downstream region at tRNA end position |
caggtggcta |
Secondary structure (Cloverleaf model) | >W1810681914 Glu CTC c ACCA caggtggcta G - C G + T C - G C - G C - G C - G A - T T A T C G C C C A C G A C | | | | | G G T A T G G C G G G C G + | | | T T C G T A C C T A G TAAC C - G T + G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |