Sequence ID | >W1810693406 |
Genome ID | QLLJ01000002 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Duganella sp. GV066 [QLLJ] |
Start position on genome | 669213 |
End posion on genome | 669138 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taaaagtcac |
tRNA gene sequence |
GCCGACTTAGCTCATTTGGTAGAGCAGTTGATTTGTAATCATCAGGTGGCCAGTTCGAAA |
Downstream region at tRNA end position |
ataaaatcaa |
Secondary structure (Cloverleaf model) | >W1810693406 Thr TGT c ACCA ataaaatcaa G - C C - G C - G G - C A - T C - G T - A A A T C G G C C A T T A A | | | | G T C T C G G C C A G C G | | | | T T G G A G C T A A AGGTG G - C T T T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |