Sequence ID | >W1810695773 |
Genome ID | QLST01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium tibetense YH5 [QLST] |
Start position on genome | 72992 |
End posion on genome | 72919 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
actcacaaat |
tRNA gene sequence |
CGCGGGATAGAGCAGTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
gaaactccaa |
Secondary structure (Cloverleaf model) | >W1810695773 Met CAT t ACta gaaactccaa C T G - C C - G G - C G - C G - C A - T T G T T G A C C A T G A A | | | | | G A C G A G A C T G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |