| Sequence ID | >SRA1008458 |
| Genome ID | SRR020490.372316 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
145
|
|
End posion on genome
|
69
|
|
Amino Acid
|
Ile
|
|
Anticodon
|
GAT
|
|
Upstream region at tRNA start position
|
taattacatt
|
|
tRNA gene sequence
|
GGGCTGGTAGCTCAGTTGGTTAGAGCGCGCGCTTGATAAGCGTGAGGTCGGAAGTTCAAG TCTTCCTCGGCCCACCA
|
|
Downstream region at tRNA end position
|
ataatagggg
|
| Secondary structure (Cloverleaf model) | >SRA1008458 Ile GAT
t ACCA ataatagggg
G - C
G - C
G - C
C - G
T + G
G - C
G + T T G
T C C T T C A
T G A A | | | | | A
T C T C G G G A A G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
G + T
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |