| Sequence ID | >SRA1008501 |
| Genome ID | SRR020490.398594 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
20
|
|
End posion on genome
|
95
|
|
Amino Acid
|
Gly
|
|
Anticodon
|
GCC
|
|
Upstream region at tRNA start position
|
acggctcgct
|
|
tRNA gene sequence
|
GCGGACGTAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGCCGGTTCGAAC CCGGTCGTCCGCTCCA
|
|
Downstream region at tRNA end position
|
gattcacccg
|
| Secondary structure (Cloverleaf model) | >SRA1008501 Gly GCC
t TCCA gattcacccg
G - C
C - G
G - C
G - C
A - T
C - G
G - C C A
T T G G C C A
T G A A + | | | | G
T C T C G G C C G G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |