Sequence ID | >W1810701627 |
Genome ID | QMEZ01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Micromonospora sp. LHW51205 [QMEZ] |
Start position on genome | 1501547 |
End posion on genome | 1501621 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
acaccagcca |
tRNA gene sequence |
GGTCCTGTGGAGCAGTTGGAGTGCTCGCCGCCCTGTCAAGGCGGAGGTCGCGGGTTCAAG |
Downstream region at tRNA end position |
gcgctgacgc |
Secondary structure (Cloverleaf model) | >W1810701627 Asp GTC a GCaa gcgctgacgc G - C G - C T - A C - G C - G T - A G - C T G T T G C C C A T G A G + | | | | A T C G A G G C G G G C G | | | | T T G G C T C A G T G AGGTC C - G C - G G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |