Sequence ID | >W1810707589 |
Genome ID | QNHO01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Lawsonia intracellularis Fu/JPN [QNHO] |
Start position on genome | 564510 |
End posion on genome | 564586 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gtcagcccgt |
tRNA gene sequence |
CGGGATGTGGCGCAGCTTGGTAGCGCACTTGAATGGGGTTCAAGGGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
gtattttaaa |
Secondary structure (Cloverleaf model) | >W1810707589 Pro GGG t ACCA gtattttaaa C - G G - C G - C G - C A - T T - A G - C T A T C G C T C A C G A G | + | | | G T C G C G G T G A G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |