Sequence ID | >W1810711849 |
Genome ID | QNKQ01000174 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas oryzae pv. oryzae HN-84-31 [QNKQ] |
Start position on genome | 3890 |
End posion on genome | 3814 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gcgcggccag |
tRNA gene sequence |
GCGCTCGTAGCTCAGCCGGATAGAGTAGTGGCTTCCGAAGCCATTGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
atttcagttc |
Secondary structure (Cloverleaf model) | >W1810711849 Arg CCG g ACCA atttcagttc G - C C - G G - C C - G T + G C - G G - C T A T C T C C C A C G A A | + | | | G C C T C G G G G G G C G | | | + T T G G A G T A T A A TGGTC G + T T - A G - C G - C C - G T A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |