Sequence ID | >W1810718689 |
Genome ID | QNPN01001055 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas oryzae pv. oryzae YN11 [QNPN] |
Start position on genome | 2836 |
End posion on genome | 2911 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccaaggacat |
tRNA gene sequence |
GGGGCGGTAGCTCAGCTGGGAGAGCGTCGCGTTCGCATCGCGAAGGTCGAGGGTTCGATC |
Downstream region at tRNA end position |
atagaatcaa |
Secondary structure (Cloverleaf model) | >W1810718689 Ala CGC t ACCA atagaatcaa G - C G - C G + T G - C C - G G - C G - C C T T T T C C C A C G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C G A G AGGTC T - A C - G G - C C - G G - C T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |