Sequence ID | >W1810725217 |
Genome ID | QOCK01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | 'Sphingomonas ginsengisoli' Hoang et al. 2012 KCTC 12630 [QOCK] |
Start position on genome | 1147539 |
End posion on genome | 1147614 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcagacgtgg |
tRNA gene sequence |
GCCCAGGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGGCGGTTCGACC |
Downstream region at tRNA end position |
tcgtttcgaa |
Secondary structure (Cloverleaf model) | >W1810725217 Phe GAA g ACCA tcgtttcgaa G - C C - G C - G C - G A - T G - C G - C C C T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |