Sequence ID | >W1810758214 |
Genome ID | QPII01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas montanilacus PYC7W [QPII] |
Start position on genome | 173709 |
End posion on genome | 173795 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atcccgtgcc |
tRNA gene sequence |
GCCCGGATGGCGAAATTGGTAGACGCAAGAGACTTAAAATCTCTCGGTGGCAACACCGTG |
Downstream region at tRNA end position |
gactcttcgc |
Secondary structure (Cloverleaf model) | >W1810758214 Leu TAA c ACCA gactcttcgc G - C C - G C - G C - G G - C G - C A - T C G T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G A CGGTGGCAACACCGT A - T G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |