Sequence ID | >W1810758329 |
Genome ID | QPIP01000003 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Cylisticus convexus of Cylisticus convexus Wcon [QPIP] |
Start position on genome | 23299 |
End posion on genome | 23227 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cataaaaaac |
tRNA gene sequence |
GGCTGGGTGGCAGAATGGCTTATGCGGAGGACTGCAAATCCTTTTATACCGGTTCAATTC |
Downstream region at tRNA end position |
atttcaatta |
Secondary structure (Cloverleaf model) | >W1810758329 Cys GCA c TCtt atttcaatta G - C G - C C - G T + G G - C G - C G - C T T T T G G C C A T A A G | | | | | A G G A C G A C C G G C G | | | T T C A T G C T T G TTAT G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |