Sequence ID | >W1810762397 |
Genome ID | QPMM01000012 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chitinophaga silvatica GDMCC 1.1288 [QPMM] |
Start position on genome | 134945 |
End posion on genome | 134872 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttaattccct |
tRNA gene sequence |
GCGGAAGTAGCTCATTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTGGCCGGTTCGAGC |
Downstream region at tRNA end position |
tttttaaaag |
Secondary structure (Cloverleaf model) | >W1810762397 Gly GCC t TCat tttttaaaag G - C C - G G - C G - C A - T A - T G - C C G T T G G C C A T T A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A A GGGTG C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |