| Sequence ID | >SRA1009169 |
| Genome ID | SRR020491.138437 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
49
|
|
End posion on genome
|
140
|
|
Amino Acid
|
Ser
|
|
Anticodon
|
GCT
|
|
Upstream region at tRNA start position
|
acacatattt
|
|
tRNA gene sequence
|
GGAGAGGTGGCCGAGCGGCTTAAGGCGGCACCCTGCTAAGGTGTTTTAGGTGAAATATCC TAACGTGGGTTCGAATCCCACCCTCTCCGCAA
|
|
Downstream region at tRNA end position
|
attttttatt
|
| Secondary structure (Cloverleaf model) | >SRA1009169 Ser GCT
t GCAA attttttatt
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C A C C C A
C G A G | | | | | G
G G C C G G T G G G C
G | | | T T
C A G G C
T T A G TTTAGGTGAAATATCCTAAC
G + T
C - G
A - T
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |