Sequence ID | >W1810768034 |
Genome ID | QQES01000011 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Neisseria meningitidis M39523 [QQES] |
Start position on genome | 10485 |
End posion on genome | 10560 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cgcaatcatt |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCGCAACCTTGCCAAGGTTGAGGTCGCGAGTTCGAGA |
Downstream region at tRNA end position |
agttttattt |
Secondary structure (Cloverleaf model) | >W1810768034 Gly GCC t TCCA agttttattt G - C C - G G - C G - C G - C A - T A - T A G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |