| Sequence ID | >SRA1009187 |
| Genome ID | SRR020491.144953 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
51
|
|
End posion on genome
|
125
|
|
Amino Acid
|
Ile
|
|
Anticodon
|
GAT
|
|
Upstream region at tRNA start position
|
cgggttctgc
|
|
tRNA gene sequence
|
GGGGCTATAGCTCAGTCGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGCTGGTTCGAT TCCAGCTAGCCCCACgt
|
|
Downstream region at tRNA end position
|
ctatggaggt
|
| Secondary structure (Cloverleaf model) | >SRA1009187 Ile GAT
c ACgt ctatggaggt
G - C
G - C
G - C
G - C
C - G
T - A
A - T T T
T C G A C C A
T G A A | | | | | G
C C T C G G C T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |