| Sequence ID | >SRA1009234 |
| Genome ID | SRR020491.160415 |
| Phylum/Class | Microbial community gene content and expression in the Central North Pacific Gyre, Station ALOHA, HOT186 (SRP001041) |
| Species | |
|
Start position on genome
|
25
|
|
End posion on genome
|
100
|
|
Amino Acid
|
Pro
|
|
Anticodon
|
TGG
|
|
Upstream region at tRNA start position
|
ttgttttgcT
|
|
tRNA gene sequence
|
GGGAGTGTGGTCTAGCTTGGTATGATTCTGCGTTTGGGACGCAGAGATCGCGCGTTCGAA TCTCGCCACTCCCATat
|
|
Downstream region at tRNA end position
|
tttatctctg
|
| Secondary structure (Cloverleaf model) | >SRA1009234 Pro TGG
T ATat tttatctctg
G - C
G - C
G - C
A - T
G - C
T - A
G - C T A
T C G C T C A
C G A G | | | | G
T T C T G G C G C G C
T | | + T T
G T G A T
G T A T AGATC
C - G
T - A
G - C
C - G
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |